View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10799_low_9 (Length: 261)

Name: NF10799_low_9
Description: NF10799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10799_low_9
NF10799_low_9
[»] chr3 (1 HSPs)
chr3 (1-240)||(52315679-52315918)


Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 52315679 - 52315918
Alignment:
Q  1 tagaaaataatagaagtatttatttatggggaaaaagcgacagaaaacaaaggaactttcatcagtagcgctagctgaggatgctgctgcatcaacagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52315679 tagaaaataatagaagtatttatttatggggaaaaagcgacagaaaacaaaggaactttcatcagtagcgctagctgaggatgctgctgcatcaacagaa 52315778  T
Q  101 ggaggtgaaccagaagaagctcctcgtcggaagagaggaaggcctcgtaaggttgttgttgttacggaaactaaggaactaaaagaggaagaggatacag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52315779 ggaggtgaaccagaagaagctcctcgtcggaagagaggaaggcctcgtaaggttgttgttgttacggaaactaaggaactaaaagaggaagaggatacag 52315878  T
Q  201 taaactcaacaaagaaagatgaacaacaagaggaatcaac 240  Q
    |||||||||||||||||||||||||||||||||| |||||    
T  52315879 taaactcaacaaagaaagatgaacaacaagaggactcaac 52315918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University