View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10798_low_36 (Length: 229)

Name: NF10798_low_36
Description: NF10798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10798_low_36
NF10798_low_36
[»] chr6 (1 HSPs)
chr6 (7-121)||(777524-777638)


Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 777524 - 777638
Alignment:
Q  7 cttttaccaatacaaataacatttgtatatttcgggcgtcttattacagatttgcttcgttaacaactttggatttgaggattagacatcaactcgatca 106  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  777524 cttttaccaatacaaataagatttatatatttcgggcgtcttattaaacatttgcttcgttaacgactttggatttgaggattagacatcaactcgatca 777623  T
Q  107 taaaaactatccaat 121  Q
    |||||||||||||||    
T  777624 taaaaactatccaat 777638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University