View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10795_high_4 (Length: 228)

Name: NF10795_high_4
Description: NF10795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10795_high_4
NF10795_high_4
[»] chr5 (1 HSPs)
chr5 (25-211)||(31193142-31193328)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 25 - 211
Target Start/End: Complemental strand, 31193328 - 31193142
Alignment:
Q  25 tgcaagcaataacaggaggaattcttacgacttacgtaaaagatgccaaacacactttccttcatcaatgtagtgcaaaagagtctagtttttaacactt 124  Q
    |||||||||||| |||||||||||||| |||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |    
T  31193328 tgcaagcaataataggaggaattcttaagacttacggaaaagatgccaaacacacttcctttcatcaatgtagtgcaaaagagtctagtttttaacacct 31193229  T
Q  125 tcatgagaagattccttttttcaaagaaggaactaaaaagacacgaagaagagattgaagaatgtttctcgattcaaagagatgcat 211  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31193228 tcatgagaagattccttgtttcaaagaaggaactaaaaagacacgaagaagagattgaagaatgtttctcgattcaaagagatgcat 31193142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University