View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10780_4 (Length: 372)

Name: NF10780_4
Description: NF10780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10780_4
NF10780_4
[»] chr1 (1 HSPs)
chr1 (94-218)||(44799682-44799806)
[»] chr3 (1 HSPs)
chr3 (183-228)||(8349624-8349669)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 8e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 94 - 218
Target Start/End: Complemental strand, 44799806 - 44799682
Alignment:
Q  94 cttaaatttctatgaagaactttatgaaggcttccatatggtaaatactcataaaccaaaaccagttcattcccttcacaacactgtcctttaagctgaa 193  Q
    |||||||| ||||| |||||||||| ||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||   |||||||||||||    
T  44799806 cttaaattcctatgcagaactttatcaaggcttccatttggtagatactcataaaccaaaaccaattcattcccttcacaacaccaccctttaagctgaa 44799707  T
Q  194 ccagattcttgtgccgcaagcaacc 218  Q
    |||||||||||||||||||||||||    
T  44799706 ccagattcttgtgccgcaagcaacc 44799682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 183 - 228
Target Start/End: Original strand, 8349624 - 8349669
Alignment:
Q  183 tttaagctgaaccagattcttgtgccgcaagcaaccaatcattgaa 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  8349624 tttaagctgaaccagattcttgtgccgcaagcaaccaatcattgaa 8349669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University