View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1077_low_41 (Length: 323)

Name: NF1077_low_41
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1077_low_41
NF1077_low_41
[»] chr1 (1 HSPs)
chr1 (95-284)||(34451898-34452087)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 95 - 284
Target Start/End: Original strand, 34451898 - 34452087
Alignment:
Q  95 aacaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt 194  Q
    |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34451898 aacaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt 34451997  T
Q  195 catatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaa 284  Q
    |||||||||||||||||||       |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||    
T  34451998 catatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaa 34452087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University