View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1077_high_63 (Length: 206)

Name: NF1077_high_63
Description: NF1077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1077_high_63
NF1077_high_63
[»] chr2 (1 HSPs)
chr2 (47-160)||(8895927-8896040)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 47 - 160
Target Start/End: Original strand, 8895927 - 8896040
Alignment:
Q  47 aatattacaattatcaacaactagccataataaaataaattagaaaccatttctaataattaattgattcccatcattaatccatatagcagattgacta 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  8895927 aatattacaattatcaacaactagccataataaaataaattagaaaccatttctaataattaattgattcccatcatcaatccatatagcagattgacta 8896026  T
Q  147 aaataaacaatcta 160  Q
    ||||||||||||||    
T  8896027 aaataaacaatcta 8896040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University