View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10779_low_17 (Length: 219)

Name: NF10779_low_17
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10779_low_17
NF10779_low_17
[»] chr3 (2 HSPs)
chr3 (17-204)||(52075262-52075449)
chr3 (24-98)||(49456430-49456504)


Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 52075262 - 52075449
Alignment:
Q  17 agaaggggtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggctttcgattggagagctattctcaaccggataccaactaaaattaac 116  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||    
T  52075262 agaagaggtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggttttcggttggagagctattctcaaccggataccaactaaaattaac 52075361  T
Q  117 ctcacattgagacatgtcttaaatgcgggagagcaaccttggtggctttgtgtaatacggtggaggaatccacaaatcaccttcttct 204  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  52075362 ctcacattgagacatgtcttaaatccgggagagcaaccttggtggctttgtgtaatagggtggaggaatccacaaatcaccttcttct 52075449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 98
Target Start/End: Original strand, 49456430 - 49456504
Alignment:
Q  24 gtttttgagaagttgtggaagtgtccggctccgtcaaaggtggtggctttcgattggagagctattctcaaccgg 98  Q
    ||||| |||| ||||||||||| |||||| |||||||||||||||||||||| |||||||||  | |||||||||    
T  49456430 gttttcgagatgttgtggaagtctccggcaccgtcaaaggtggtggctttcgcttggagagcattcctcaaccgg 49456504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University