View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10779_low_16 (Length: 220)

Name: NF10779_low_16
Description: NF10779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10779_low_16
NF10779_low_16
[»] chr7 (1 HSPs)
chr7 (89-203)||(29959662-29959776)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 89 - 203
Target Start/End: Original strand, 29959662 - 29959776
Alignment:
Q  89 agtctacgagatcactgtcaaaatttaattatcagtatgatgcaattttctttttcagtgtgattattatcaaggtacagcaaaagaacaacaatgtccc 188  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29959662 agtctacgagatcactgtcaaaatttaattatcaatgtgatgcaattttctttttcagtgtgattattatcaaggtacagcaaaagaacaacaatgtccc 29959761  T
Q  189 agacggcaagaaaag 203  Q
    |||||||||||||||    
T  29959762 agacggcaagaaaag 29959776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University