View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10774_low_2 (Length: 242)

Name: NF10774_low_2
Description: NF10774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10774_low_2
NF10774_low_2
[»] chr2 (2 HSPs)
chr2 (1-119)||(39077903-39078021)
chr2 (143-224)||(39077791-39077873)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 39078021 - 39077903
Alignment:
Q  1 actatcttttagcacatgagttggttacaaatcccataaacaaaaaagcattgagtaattaacttttgttatcttgcatatgcatatgcatattttagag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39078021 actatcttttagcacatgagttggttacaaatcccataaacaaaaaagcattgagtaattaacttttgttatcttgcatatgcatatgcatattttagag 39077922  T
Q  101 tactatattgctattacat 119  Q
    |||||||||||||||||||    
T  39077921 tactatattgctattacat 39077903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 143 - 224
Target Start/End: Complemental strand, 39077873 - 39077791
Alignment:
Q  143 aggatcaatataagtggtagaattaagggttattttcagcttcaga-aaaagtatccacatgaagaaattctataagaaatcc 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  39077873 aggatcaatataagtggtagaattaagggttattttcagcttcagaaaaaagtatccacatgaagaaattctataagaaatcc 39077791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University