View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10761_low_29 (Length: 217)

Name: NF10761_low_29
Description: NF10761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10761_low_29
NF10761_low_29
[»] chr5 (1 HSPs)
chr5 (66-202)||(15053991-15054127)


Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 66 - 202
Target Start/End: Complemental strand, 15054127 - 15053991
Alignment:
Q  66 cgttgctctaaatggaaaaatctgcaattttcaacgacaattatcttctttttccgccagatctaaactgtcgtccacaaatgtcctagggttttggcca 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  15054127 cgttgctctaaatggaaaaatctgcaattttcaacgacaattatcttctttttccgccagatctaaactgtcgtccacaaatgtactagggttttggcca 15054028  T
Q  166 agttctcttgtaagttgtttcttgaatctatttcaat 202  Q
    |||||||||||||||||||||||||||||||||||||    
T  15054027 agttctcttgtaagttgtttcttgaatctatttcaat 15053991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University