View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10759_low_43 (Length: 205)

Name: NF10759_low_43
Description: NF10759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10759_low_43
NF10759_low_43
[»] chr8 (2 HSPs)
chr8 (1-188)||(38339470-38339657)
chr8 (130-166)||(38331618-38331654)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 38339657 - 38339470
Alignment:
Q  1 ttctaataaggcagaacaagataccgctagagatgcctccagatttcatgccaggggaggtggttgaagacccgacacatggaacaaatgtatgcacttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  38339657 ttctaataaggcagaacaagataccgctagagatgcctccaaatttcatgccaggggaggtggttgaagacccgacacatggaactaatgtatgcacttt 38339558  T
Q  101 ttgctagtttggttttannnnnnnnatgccactattcttttgatgcacatggtttatgataattttattataaatgtaatatttatca 188  Q
    |||||||||||||||||        ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38339557 ttgctagtttggttttattttttttatgccactatttttttgatgcacatggtttatgataattttattataaatgtaatatttatca 38339470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 166
Target Start/End: Complemental strand, 38331654 - 38331618
Alignment:
Q  130 cactattcttttgatgcacatggtttatgataatttt 166  Q
    ||||||||||||||||||||||||||||| |||||||    
T  38331654 cactattcttttgatgcacatggtttatggtaatttt 38331618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University