View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10758_high_1 (Length: 299)

Name: NF10758_high_1
Description: NF10758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10758_high_1
NF10758_high_1
[»] chr3 (1 HSPs)
chr3 (40-286)||(43482763-43483009)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 40 - 286
Target Start/End: Complemental strand, 43483009 - 43482763
Alignment:
Q  40 aaatccatgcaactttcaataactaaaaccgggtgaaaatgtcacgtaccttctggcacaagataatgacatccacgattcatgtctgatgtattgccaa 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  43483009 aaatccatgcaactttcaataactaaaaccgggtgaaaatgtcacgtaccttctggcacaagataatgacatccacgattcatgtctgatgtatttccaa 43482910  T
Q  140 aactttgagnnnnnnntgtatcaaattttgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgc 239  Q
    |||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43482909 aactttgagaaaaaaatgtatcaaattttgagttgggccattggatatgtgccgcaatttgcagacaaggtaataccttcaagccctgcaacataggtgc 43482810  T
Q  240 ggggccatatgtcaggtctgtaaccagtttaccctgccatcacttct 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  43482809 ggggccatatgtcaggtctgtaaccagtttaccctgccatcacttct 43482763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University