View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10751_low_7 (Length: 340)

Name: NF10751_low_7
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10751_low_7
NF10751_low_7
[»] chr3 (3 HSPs)
chr3 (19-166)||(52035632-52035779)
chr3 (196-247)||(52035590-52035641)
chr3 (273-323)||(52035539-52035589)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 19 - 166
Target Start/End: Complemental strand, 52035779 - 52035632
Alignment:
Q  19 atcatagctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaatttt 118  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52035779 atcatcgctcatacggcaagttgagtcgagttaaaaatgacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaatttt 52035680  T
Q  119 agctactttatttatttcattctctaaaaaatgacacttttttaaaaa 166  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||    
T  52035679 agctactttatttatttcattctctaaaaaatgacacttttgtaaaaa 52035632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 196 - 247
Target Start/End: Complemental strand, 52035641 - 52035590
Alignment:
Q  196 tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52035641 tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc 52035590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 273 - 323
Target Start/End: Complemental strand, 52035589 - 52035539
Alignment:
Q  273 aatgaaccactttattctctctgaccaatttcaacataagactgcctcaat 323  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  52035589 aatgaaccactttattgtctctgaccaatttcaacataagactgcctcaat 52035539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University