View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10751_low_17 (Length: 251)

Name: NF10751_low_17
Description: NF10751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10751_low_17
NF10751_low_17
[»] chr3 (1 HSPs)
chr3 (27-251)||(44256770-44256994)
[»] chr8 (2 HSPs)
chr8 (31-168)||(20473431-20473568)
chr8 (31-168)||(20474954-20475090)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 27 - 251
Target Start/End: Complemental strand, 44256994 - 44256770
Alignment:
Q  27 gaatatgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccac 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44256994 gaatatgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccac 44256895  T
Q  127 tcttcttaccccgaatccgtttcctatgaacgtctcgagttcatcggcgatgccgtattaggccacgctatgagcaaccatctcttcctcgtttacacta 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  44256894 tcttcttaccccgaatccgtttcctatgaacgtctcgagttcatcggcgatgccgtattaggccacgctatcagcaaccatctcttcctcgtttacacta 44256795  T
Q  227 acgttgaccaacgtcaactctctct 251  Q
    |||||||||||||||||||||||||    
T  44256794 acgttgaccaacgtcaactctctct 44256770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 31 - 168
Target Start/End: Complemental strand, 20473568 - 20473431
Alignment:
Q  31 atgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccactctt 130  Q
    ||||| ||| ||||||||| ||| |||||||||||||||||||||||||| ||||| |||   |||||||| ||||||||||| ||| |||||||| |||    
T  20473568 atgaaaatggagatggaagcttcagttgcagcagtggagaagataatcggctacacattcctcaacaagaagcttctagaagatgctctaacccacactt 20473469  T
Q  131 cttaccccgaatccgtttcctatgaacgtctcgagttc 168  Q
    ||||||||||||| |||||||| |||||||||||||||    
T  20473468 cttaccccgaatctgtttcctacgaacgtctcgagttc 20473431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 168
Target Start/End: Original strand, 20474954 - 20475090
Alignment:
Q  31 atgaagatgaagatggaagattctgttgcagcagtggagaagataatcgggtacaccttcagaaacaagaaccttctagaagaagctttaacccactctt 130  Q
    ||||||||| ||||||||| |||  ||||||||||||| |||||||| || ||||| |||   |||||||| ||| ||||||| || ||||| ||  |||    
T  20474954 atgaagatggagatggaaggttcaattgcagcagtggaaaagataattggctacacattcctcaacaagaagctt-tagaagatgcattaactcatactt 20475052  T
Q  131 cttaccccgaatccgtttcctatgaacgtctcgagttc 168  Q
    |||||||||||||||||||||| |||||||||||||||    
T  20475053 cttaccccgaatccgtttcctacgaacgtctcgagttc 20475090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University