View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10747_low_10 (Length: 236)

Name: NF10747_low_10
Description: NF10747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10747_low_10
NF10747_low_10
[»] chr3 (1 HSPs)
chr3 (18-222)||(52587631-52587835)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 52587835 - 52587631
Alignment:
Q  18 agaactgcgtcatatatagactcataggtctgagggagggtagatagatagatggtagaaactaatgtatagatatagatctgctagctggggctggaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  52587835 agaactgcgtcatatatagactcataggtctgagggagggtagatagatagatggtagaaactaatgtatagatatagatctgctagctagggctggaaa 52587736  T
Q  118 attattattgttaatattcgttgatttatgatcatcaaaggtatttttgtatccttgttgaaacttgaaactgctagggctatagaggaggtgtggctgc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52587735 attattattgttaatattcgttgatttatgatcatcaaaggtatttttgtatccttgttgaaacttgaaactgctagggctatagaggaggtgtggctgc 52587636  T
Q  218 ctttg 222  Q
    |||||    
T  52587635 ctttg 52587631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University