View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10745_high_16 (Length: 259)

Name: NF10745_high_16
Description: NF10745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10745_high_16
NF10745_high_16
[»] chr4 (1 HSPs)
chr4 (2-235)||(19175537-19175770)
[»] chr2 (1 HSPs)
chr2 (104-166)||(36405878-36405940)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 235
Target Start/End: Original strand, 19175537 - 19175770
Alignment:
Q  2 acagagcaagagatatcctttttggccattctcgtgacccttttcaggaaatccctagtttcttgcgctagtgatgcttctgccatggaaattggtcacc 101  Q
    |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  19175537 acagagcaagagttatcctttttggccattcttgtgacccttttcaggaaatccctagtttcttgcgccagtgatgcttctgccatggaaattggtcacc 19175636  T
Q  102 ctactaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtccccactacacctcc 201  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19175637 ctactaatgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtccccactacacctcc 19175736  T
Q  202 cagtgctaggtaggtttgttgctacattgttctt 235  Q
    ||||||||||||||||||||||||||||||||||    
T  19175737 cagtgctaggtaggtttgttgctacattgttctt 19175770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 104 - 166
Target Start/End: Original strand, 36405878 - 36405940
Alignment:
Q  104 actaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcct 166  Q
    ||||||||||||||| | || || || || ||||||||||| |||||||||||||||||||||    
T  36405878 actaacgtgcgccatgtcgctcacgttacttttgataggttcaatggtttcttgggtttgcct 36405940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University