View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10742_low_26 (Length: 250)

Name: NF10742_low_26
Description: NF10742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10742_low_26
NF10742_low_26
[»] chr7 (2 HSPs)
chr7 (1-200)||(25829554-25829755)
chr7 (198-246)||(25829470-25829518)


Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 25829755 - 25829554
Alignment:
Q  1 ccaacaattggtattggatgacattgttctcaactatgtattgacataattaagcattattgttataactatcatatgttgattatgggttatttttgta 100  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25829755 ccaacaattggtattggatgacattgttctcaattatgtattgacataattaagcattattgttataactatcatatgttgattatgggttatttttgta 25829656  T
Q  101 tactgaagttgtatctagtcatttaagtcttttttaaattacggaccttataaaatgtttttccaaaattgaaatagtaac--aacaaatggatatataa 198  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||  |||||||||||||||||  ||||||||| |||||||    
T  25829655 tactgaagttgtatctagtcatttaagttttttttaaattacggaccttataaaatgcttttttaaaattgaaatagtaacataacaaatggttatataa 25829556  T
Q  199 ta 200  Q
    ||    
T  25829555 ta 25829554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 198 - 246
Target Start/End: Complemental strand, 25829518 - 25829470
Alignment:
Q  198 atattgtttgtgatttagaaaagaaaaataagtcttccctttgcttctc 246  Q
    ||||||||||||||||||||||||||||||||||| ||| || ||||||    
T  25829518 atattgtttgtgatttagaaaagaaaaataagtctccccctttcttctc 25829470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University