View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10741_low_8 (Length: 359)

Name: NF10741_low_8
Description: NF10741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10741_low_8
NF10741_low_8
[»] chr1 (1 HSPs)
chr1 (6-281)||(37584553-37584832)


Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 6 - 281
Target Start/End: Original strand, 37584553 - 37584832
Alignment:
Q  6 aaaaactactcaagagaagaaaaaacgccagattcacatgcatgagg----gacaatagcttcttggtgttatggatcagatggtgcagccataggacag 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  37584553 aaaaactactcaagagaagaaaaaacgccagattcacatgcatgagggagggacaatagcttcttggtgttatggatcagatggtgcagccataggacag 37584652  T
Q  102 gaagaagaagcagagcatagagacaagagcgactgactcgaaagccgtaacgattccccacacaaattcatccacaatggagatgtttatgagctccgac 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37584653 gaagaagaagcagagcatagagacaagagcgactgactcgaaagccgtaacgattccccacacaaattcatccacaatggagatgtttatgagctccgac 37584752  T
Q  202 caccgcgttgctgataatttcaacattaccctacggaatactgatgccattggtgaacacactgtttcaaatcaaaacgc 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  37584753 caccgcgttgctgataatttcaacattaccctacggaatactgatgccattggcgaacacactgtttcaaatcaaaacgc 37584832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University