View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10736_high_18 (Length: 208)

Name: NF10736_high_18
Description: NF10736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10736_high_18
NF10736_high_18
[»] chr4 (1 HSPs)
chr4 (1-166)||(23617893-23618058)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 23617893 - 23618058
Alignment:
Q  1 aacgtccatccataaaacaattccttttgcgggctttggaaacatagaaattgaaatat----tttaatttgtgcatgccacttattttattggtggaaa 96  Q
    ||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||    || | ||||||||||||||||||||||||||||||||    
T  23617893 aacgtccatccataaaacaattctttttgcaggctttgaaaacatagaaattgaaatatatgtttcagtttgtgcatgccacttattttattggtggaaa 23617992  T
Q  97 tggaaaagaacaactagcaaagaaatggagaaaatttgagaaataacataacacttgatccttattgaca 166  Q
    ||||||||||||||||||    ||||||||||||||||||||  ||||||||||||||||||||||||||    
T  23617993 tggaaaagaacaactagc----aaatggagaaaatttgagaacaaacataacacttgatccttattgaca 23618058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University