View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10732_low_11 (Length: 205)

Name: NF10732_low_11
Description: NF10732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10732_low_11
NF10732_low_11
[»] chr3 (1 HSPs)
chr3 (27-189)||(34270209-34270371)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 27 - 189
Target Start/End: Original strand, 34270209 - 34270371
Alignment:
Q  27 tgatcaacccctgcaaagcttgacatgtggagaatttagtacatggcctccccgtaatctccacatcatatgatgccacgttggtgcaaccttctgtaca 126  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34270209 tgatcaacccctgcaaagcttgacatgtggagaatttagtacacggcctccccgtaatctccacatcatatgatgccacgttggtgcaaccttctgtaca 34270308  T
Q  127 tatatgtttcaaacattgtacagcttcacttaattgcacaaacaacttttgttcttccctatg 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34270309 tatatgtttcaaacattgtacagcttcacttaattgcacaaacaacttttgttcttccctatg 34270371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University