View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10722_high_49 (Length: 227)

Name: NF10722_high_49
Description: NF10722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10722_high_49
NF10722_high_49
[»] chr4 (3 HSPs)
chr4 (9-78)||(10474367-10474436)
chr4 (9-78)||(10463425-10463494)
chr4 (99-227)||(10463248-10463380)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 10474436 - 10474367
Alignment:
Q  9 atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcaaccaccagttc 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  10474436 atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcagccaccagttc 10474367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 9 - 78
Target Start/End: Complemental strand, 10463494 - 10463425
Alignment:
Q  9 atttgttgacgcatctgaaccgcataagagattttactgcgagaaaggatagtacttcaaccaccagttc 78  Q
    ||||||||||||| ||||| |||||||||| |||||||||||| | ||||||||||||| ||||||||||    
T  10463494 atttgttgacgcacctgaatcgcataagaggttttactgcgagcagggatagtacttcagccaccagttc 10463425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 99 - 227
Target Start/End: Complemental strand, 10463380 - 10463248
Alignment:
Q  99 ccatggagccgccttgcatgtggttaggtagaagaattaaccctagaaag----tgaa-ccaaaacgaagcaaccaggttgaatattgcgacgttttaat 193  Q
    |||||| |||||| |||||||||| |  |||||||||||||||||| |||    |||| ||||||| ||||||||| |||||||  ||| || |||||||    
T  10463380 ccatggtgccgccgtgcatgtggtcacctagaagaattaaccctagcaagcaactgaaaccaaaactaagcaaccaagttgaatcgtgcaac-ttttaat 10463282  T
Q  194 atttgtttctttctgggctgttgtataatgggtt 227  Q
    || ||||||||| |||||| ||||||||||||||    
T  10463281 atatgtttctttttgggcttttgtataatgggtt 10463248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University