View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10720_low_30 (Length: 238)

Name: NF10720_low_30
Description: NF10720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10720_low_30
NF10720_low_30
[»] chr1 (1 HSPs)
chr1 (15-222)||(52287568-52287775)


Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 52287568 - 52287775
Alignment:
Q  15 aagaatcagatggtgaaatattgcaggactcaaatggtgtgccggtgatcggcgttgtaaaagtagtagtggctaatggagtgctatagaactcttcaaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52287568 aagaatcagatggtgaaatattgcaggactcaaatggtgtgccggtgatcggcgttgtaaaagtagtagtggctaatggagtgctatagaactcttcaaa 52287667  T
Q  115 gatatctttttcaacctcaaaaggtttgtgagggttttgaaggagtttttcaaccatttgtaaccgaggtggaaggtgaagggggaggagttttcctttg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52287668 gatatctttttcaacctcaaaaggtttgtgagggttttgaaggagtttttcaaccatttgtaaccgaggtggaaggtgaagggggaggagttttcctttg 52287767  T
Q  215 tagaaaag 222  Q
    ||||||||    
T  52287768 tagaaaag 52287775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University