View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10719_low_52 (Length: 213)

Name: NF10719_low_52
Description: NF10719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10719_low_52
NF10719_low_52
[»] chr4 (1 HSPs)
chr4 (17-123)||(4720377-4720484)
[»] chr8 (2 HSPs)
chr8 (40-102)||(22494812-22494873)
chr8 (42-102)||(9428881-9428940)
[»] scaffold0007 (1 HSPs)
scaffold0007 (128-173)||(251417-251462)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 17 - 123
Target Start/End: Complemental strand, 4720484 - 4720377
Alignment:
Q  17 ttttttatggaccaaataacaattggaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaata-tccctcagtagttaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  ||||||  ||||| ||||||||    
T  4720484 ttttttatggaccaaataacaattggaaaattgttgttgacacttaacataaaggttgaaaaacaccagtaaaatacataaataccccctcggtagttaa 4720385  T
Q  116 ccatcaaa 123  Q
    ||| ||||    
T  4720384 ccaccaaa 4720377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 40 - 102
Target Start/End: Original strand, 22494812 - 22494873
Alignment:
Q  40 tggaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaatatc 102  Q
    |||||||||||||||||||||||| | || || |||||||||||||||||||| |||||||||    
T  22494812 tggaaaattgttgttgacacttaacagaa-ggctgaaaaacaccagtaaaatacgtaaatatc 22494873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 42 - 102
Target Start/End: Original strand, 9428881 - 9428940
Alignment:
Q  42 gaaaattgttgttgacacttaaaataaaggttgaaaaacaccagtaaaatatgtaaatatc 102  Q
    |||||||||||||||||||| | |||| ||||||||||||||| ||||||| | |||||||    
T  9428881 gaaaattgttgttgacacttcacataa-ggttgaaaaacaccaataaaatacgcaaatatc 9428940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 128 - 173
Target Start/End: Complemental strand, 251462 - 251417
Alignment:
Q  128 atgcgtcctttatacaaaaatagaagcatcattttcatatcagttt 173  Q
    |||||||||||||||| ||| | |||||||| ||||||||||||||    
T  251462 atgcgtcctttatacataaacataagcatcagtttcatatcagttt 251417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University