View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10715_low_5 (Length: 241)

Name: NF10715_low_5
Description: NF10715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10715_low_5
NF10715_low_5
[»] chr7 (1 HSPs)
chr7 (47-211)||(47117006-47117170)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 47 - 211
Target Start/End: Original strand, 47117006 - 47117170
Alignment:
Q  47 tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47117006 tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatca 47117105  T
Q  147 ccatcttcgccggtgatgatgtcgccattgaaccgacatgctcgtgcaggttccacaggttctgc 211  Q
    || ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  47117106 ccgtcttcaccggtgatgatgtcgccattgaatcgacatgctcgtgcaggttccacaggttctgc 47117170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University