View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_low_84 (Length: 205)

Name: NF10707_low_84
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_low_84
NF10707_low_84
[»] chr2 (1 HSPs)
chr2 (20-186)||(11202840-11203006)


Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 11202840 - 11203006
Alignment:
Q  20 ttaaattggatggtgatggtggatttgaaaatttagtgaagcataaacaatgtgtcactgcggtggctttatctgaggacgattctaaggggttttcggc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11202840 ttaaattggatggtgatggtggatttgaaaatttagtgaagcataaacaatgtgtcactgcggtggctttatctgaggacgattctaaggggttttcggc 11202939  T
Q  120 ttcgaaagatggaagcattgtgcaatgggatgttgagagcgggaaatgtgagaggtataagtggccc 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11202940 ttcgaaagatggaagcattgtgcaatgggatgttgagagcgggaaatgtgagaggtataagtggccc 11203006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University