View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_low_81 (Length: 208)

Name: NF10707_low_81
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_low_81
NF10707_low_81
[»] chr6 (1 HSPs)
chr6 (18-157)||(12104012-12104151)


Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 12104151 - 12104012
Alignment:
Q  18 aaatcaattttatagaatcaatccggttaaaaccaatccactcaaacataaatggctttgcatttctgcgttttttgtgcggtctgatcatgggattgta 117  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12104151 aaatcaattttatagaatcaatcctgttaaaaccaatccactcaaacataaatggctttgcatttctgcgttttttgtgcggtctgatcatgggattgta 12104052  T
Q  118 gaggctttgagctgcaactctgcaattttttcagctcagt 157  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  12104051 gaggctttgagctgcaactctgcaattttttcagctcagt 12104012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University