View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_low_25 (Length: 343)

Name: NF10707_low_25
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_low_25
NF10707_low_25
[»] chr1 (3 HSPs)
chr1 (180-298)||(32453490-32453608)
chr1 (21-144)||(32453330-32453453)
chr1 (180-278)||(50564014-50564112)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 180 - 298
Target Start/End: Original strand, 32453490 - 32453608
Alignment:
Q  180 tacaacttcttccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttctttgcaaaactgaagagaaag 279  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||    
T  32453490 tacaacttctcccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttcttcgcagaactgaagagaaag 32453589  T
Q  280 atgagagaaagctttactc 298  Q
    |||||||||||||||||||    
T  32453590 atgagagaaagctttactc 32453608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 21 - 144
Target Start/End: Original strand, 32453330 - 32453453
Alignment:
Q  21 tagtgattgttgcggggatcacataaattttaaaattgaaccatttgtctttagagttaattgtttaatatgaaatagataatcttgactcttacactct 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |    
T  32453330 tagtgattgttgcggggatcacataaattttaaaattgaaccatttgtctttagagttaattgtttaatctgaaatagataaacttgactcttacactgt 32453429  T
Q  121 gtttgatacacaagaaataagggc 144  Q
    ||||| ||| ||||||||||||||    
T  32453430 gtttggtacgcaagaaataagggc 32453453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 50564112 - 50564014
Alignment:
Q  180 tacaacttcttccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttctttgcaaaactgaagagaaa 278  Q
    |||||||||| ||||||| |||||| ||||||||||||||||||  |||||||| |||||||||||||||||||||||||| ||| |||||||||||||    
T  50564112 tacaacttctcccgtttaaaagatcgaagaaatagagaagagataccaatttcacgtggatcccatgcttttctttttcttcgcagaactgaagagaaa 50564014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University