View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10706_low_19 (Length: 251)

Name: NF10706_low_19
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10706_low_19
NF10706_low_19
[»] chr5 (1 HSPs)
chr5 (1-239)||(29216009-29216261)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 29216009 - 29216261
Alignment:
Q  1 tttctaaaataaatgcactcttannnnnnnaggggaaaatgtacttttaggggcactccatttattaccgtatatgcagcaaaccgtgtgaaattgaatt 100  Q
    |||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  29216009 tttctaaaataaatgcactcttatttttttaggggaaaatgtacttttaggggcactccatttattaccgtatatgcagcaaaccgtgtgaaattgcatt 29216108  T
Q  101 gaat------------aaataaaaagattcctttttacatttctctaaaaatgaaaatttccctttataaataaattatcccacaca--tggaaattcaa 186  Q
    ||||            |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |  |||||  |||||||||||    
T  29216109 gaatccataaataaataaataaaaagattcttttttacatttctctaaaaatgaaaatttccctttataaataaattaccatacacatgtggaaattcaa 29216208  T
Q  187 ttttccaattcaaccaaccaaacaactccttaacacaaacatcactccccctt 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  29216209 ttttccaattcaaccaaccaaacaactccttaacacaaacatcactctccctt 29216261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University