View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10706_high_3 (Length: 434)

Name: NF10706_high_3
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10706_high_3
NF10706_high_3
[»] chr4 (12 HSPs)
chr4 (14-244)||(33169119-33169348)
chr4 (241-393)||(17086003-17086155)
chr4 (238-397)||(34194598-34194757)
chr4 (238-394)||(21964254-21964410)
chr4 (238-394)||(21979497-21979653)
chr4 (319-369)||(6558172-6558222)
chr4 (319-362)||(1894993-1895036)
chr4 (319-362)||(1909794-1909837)
chr4 (319-368)||(12784820-12784869)
chr4 (321-362)||(15652308-15652349)
chr4 (281-310)||(40465020-40465049)
chr4 (281-393)||(15082515-15082627)
[»] chr7 (10 HSPs)
chr7 (236-393)||(16440573-16440730)
chr7 (238-421)||(16161654-16161837)
chr7 (241-393)||(16455475-16455628)
chr7 (264-388)||(17242238-17242362)
chr7 (329-362)||(5802941-5802974)
chr7 (326-362)||(23764216-23764252)
chr7 (326-376)||(7368335-7368385)
chr7 (319-369)||(15853378-15853428)
chr7 (319-369)||(16036024-16036074)
chr7 (319-369)||(16050748-16050798)
[»] scaffold0003 (1 HSPs)
scaffold0003 (241-393)||(18684-18836)
[»] chr5 (18 HSPs)
chr5 (238-397)||(26772842-26773001)
chr5 (238-397)||(27283079-27283238)
chr5 (241-385)||(22897942-22898086)
chr5 (238-394)||(33510912-33511068)
chr5 (238-394)||(33526175-33526331)
chr5 (237-393)||(30144273-30144428)
chr5 (237-393)||(30178323-30178478)
chr5 (319-369)||(34494476-34494526)
chr5 (264-310)||(28899243-28899289)
chr5 (264-310)||(28935638-28935684)
chr5 (384-421)||(18118872-18118909)
chr5 (384-421)||(18129252-18129289)
chr5 (265-310)||(23723641-23723686)
chr5 (323-369)||(22269842-22269888)
chr5 (268-310)||(30956018-30956060)
chr5 (281-358)||(11544885-11544962)
chr5 (281-358)||(11558944-11559021)
chr5 (277-310)||(30929143-30929176)
[»] scaffold0252 (1 HSPs)
scaffold0252 (238-397)||(1085-1244)
[»] scaffold0027 (1 HSPs)
scaffold0027 (238-394)||(129917-130073)
[»] chr6 (16 HSPs)
chr6 (238-394)||(7987116-7987272)
chr6 (238-394)||(30563526-30563682)
chr6 (237-393)||(27002227-27002382)
chr6 (237-393)||(27017733-27017888)
chr6 (238-394)||(27192209-27192365)
chr6 (238-394)||(27204062-27204218)
chr6 (238-394)||(27245013-27245169)
chr6 (238-394)||(27256876-27257032)
chr6 (246-394)||(30548255-30548403)
chr6 (317-362)||(20133585-20133630)
chr6 (317-362)||(22199239-22199284)
chr6 (268-310)||(22940514-22940556)
chr6 (268-310)||(23862958-23863000)
chr6 (319-369)||(25178762-25178812)
chr6 (277-310)||(30721773-30721806)
chr6 (281-317)||(18939635-18939671)
[»] chr3 (16 HSPs)
chr3 (238-394)||(17975003-17975159)
chr3 (238-394)||(17990551-17990707)
chr3 (238-394)||(18219688-18219844)
chr3 (238-394)||(18234996-18235152)
chr3 (237-393)||(28333779-28333934)
chr3 (237-393)||(28348881-28349036)
chr3 (265-314)||(28166920-28166969)
chr3 (319-369)||(14142558-14142608)
chr3 (319-369)||(18525048-18525098)
chr3 (319-368)||(23012594-23012643)
chr3 (321-369)||(19448511-19448559)
chr3 (326-360)||(15365064-15365098)
chr3 (277-310)||(4653281-4653314)
chr3 (348-388)||(17786865-17786905)
chr3 (348-388)||(19088386-19088426)
chr3 (348-388)||(19364876-19364916)
[»] chr2 (12 HSPs)
chr2 (238-394)||(16819643-16819799)
chr2 (238-394)||(16834884-16835040)
chr2 (238-394)||(16874865-16875021)
chr2 (238-394)||(32059536-32059692)
chr2 (238-394)||(32044340-32044496)
chr2 (237-388)||(35763430-35763580)
chr2 (264-310)||(10116403-10116449)
chr2 (319-369)||(21693878-21693928)
chr2 (319-369)||(21708659-21708709)
chr2 (329-362)||(39884674-39884707)
chr2 (329-362)||(39900250-39900283)
chr2 (319-376)||(29439332-29439389)
[»] chr8 (3 HSPs)
chr8 (238-394)||(4486592-4486748)
chr8 (268-310)||(17896831-17896873)
chr8 (329-362)||(19697664-19697697)
[»] scaffold1536 (1 HSPs)
scaffold1536 (238-394)||(1040-1196)
[»] chr1 (4 HSPs)
chr1 (295-397)||(47767122-47767224)
chr1 (264-310)||(16653689-16653735)
chr1 (323-369)||(16404800-16404846)
chr1 (319-369)||(20344332-20344382)
[»] scaffold0021 (2 HSPs)
scaffold0021 (319-393)||(179180-179254)
scaffold0021 (319-369)||(98267-98317)
[»] scaffold0750 (1 HSPs)
scaffold0750 (319-369)||(152-202)
[»] scaffold0347 (1 HSPs)
scaffold0347 (319-369)||(17245-17295)
[»] scaffold0184 (1 HSPs)
scaffold0184 (319-367)||(21881-21929)
[»] scaffold0078 (1 HSPs)
scaffold0078 (319-367)||(50915-50963)
[»] scaffold1665 (1 HSPs)
scaffold1665 (329-372)||(838-881)
[»] scaffold0740 (1 HSPs)
scaffold0740 (323-369)||(945-991)
[»] scaffold0260 (1 HSPs)
scaffold0260 (319-369)||(6655-6705)
[»] scaffold0235 (1 HSPs)
scaffold0235 (326-376)||(209-259)
[»] scaffold0225 (1 HSPs)
scaffold0225 (277-310)||(273-306)
[»] scaffold0393 (1 HSPs)
scaffold0393 (281-393)||(6100-6212)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 33169119 - 33169348
Alignment:
Q  14 gtggtgctggtggagctgttgaaactgaaggagttggatttgtaggagtgacggttccacttcctgttggtggtgggtaacatggatagggacaaggggt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  33169119 gtggtgctggtggagctgttgaaactgaaggagttggatttgtaggagtgacggttccacttcctgtgggtggtgggtaacatggatagggacaaggggt 33169218  T
Q  114 gtcggattttcttgtggttggaaaacagaggagtgttattgagaggaagaaaagaatggaagtggttgagtttaaagatagacatgtttggatggaatga 213  Q
    |||||||||| |||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||    
T  33169219 gtcggattttgttgtggctggaaaacagaggagtgttattgagaggaagaagagagtggaagtggttgag-ttaaagatagacatgtttggatggaatga 33169317  T
Q  214 aaaagatggtaaaatgattgaaggaaatgaa 244  Q
    ||||||||||||||||||| | |||||||||    
T  33169318 aaaagatggtaaaatgattaagggaaatgaa 33169348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 241 - 393
Target Start/End: Original strand, 17086003 - 17086155
Alignment:
Q  241 tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt 340  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  17086003 tgaataaaccggcgcattaggcctttatatagagcgctagaccggaccggttcaagaccggtctaatcccctgcgttgtgagcctttagatctagggttt 17086102  T
Q  341 gggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  17086103 gggatcttggatcaatccaacgatccctgagcgtctctgtgagatccgtatcc 17086155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Complemental strand, 34194757 - 34194598
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||    
T  34194757 aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg 34194658  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg 397  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  34194657 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg 34194598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 21964254 - 21964410
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  21964254 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 21964353  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  21964354 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 21964410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 21979497 - 21979653
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  21979497 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 21979596  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  21979597 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 21979653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 6558222 - 6558172
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  6558222 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 6558172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 319 - 362
Target Start/End: Original strand, 1894993 - 1895036
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||  || |||||||||||||||    
T  1894993 tgagcctttagatctagggtttggcttcctggatcaatccaacg 1895036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 319 - 362
Target Start/End: Original strand, 1909794 - 1909837
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||  || |||||||||||||||    
T  1909794 tgagcctttagatctagggtttggcttcctggatcaatccaacg 1909837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 368
Target Start/End: Original strand, 12784820 - 12784869
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccct 368  Q
    ||||||||||||||||||||| ||  || ||||||||||||||| |||||    
T  12784820 tgagcctttagatctagggttaggcttcctggatcaatccaacgctccct 12784869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 362
Target Start/End: Complemental strand, 15652349 - 15652308
Alignment:
Q  321 agcctttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||  || |||||||||||||||    
T  15652349 agcctttagatctagggtttggcttcctggatcaatccaacg 15652308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 310
Target Start/End: Complemental strand, 40465049 - 40465020
Alignment:
Q  281 accggactggttcaagaccggtccaatccc 310  Q
    ||||||||||||||||||||||||||||||    
T  40465049 accggactggttcaagaccggtccaatccc 40465020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 393
Target Start/End: Complemental strand, 15082627 - 15082515
Alignment:
Q  281 accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgt 380  Q
    ||||||| |||||||  | |||||||| ||||  | | || ||||||||||||||| ||| |  || |||||| |||||||||||||||||| | || ||    
T  15082627 accggaccggttcaattctggtccaattccctttgatctgcgcctttagatctaggtttttgcttcctggatcgatccaacgatccctgagctttcccgt 15082528  T
Q  381 gagatccgtatcc 393  Q
    | |||||| ||||    
T  15082527 gtgatccggatcc 15082515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 146; Significance: 9e-77; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 236 - 393
Target Start/End: Complemental strand, 16440730 - 16440573
Alignment:
Q  236 ggaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctag 335  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  16440730 ggaagtgaataaaccggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcctttagatctag 16440631  T
Q  336 ggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  16440630 ggtttgggagcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 16440573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 238 - 421
Target Start/End: Original strand, 16161654 - 16161837
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| ||||||||||  |||| |||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||    
T  16161654 aaatgaaaaaaccggcgcgctagggttttatatagagcgttagaccggaccggttcaagaccggtccaattccctgcgttgtgagcccttagatctaggg 16161753  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttgagtgtgggctttgggtttgggcct 421  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  16161754 tttggggtcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatccattgagtgtgggctttgggtttgggcct 16161837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 241 - 393
Target Start/End: Complemental strand, 16455628 - 16455475
Alignment:
Q  241 tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccct-gcgttgtgagcctttagatctagggtt 339  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  16455628 tgaataaatcggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtccaatccccttgcgttgtgagcctttagatctagggtt 16455529  T
Q  340 tgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
T  16455528 tgggatcttggatcaatccaacgaaccctgagcgtctctgtgagatccgtatcc 16455475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 264 - 388
Target Start/End: Original strand, 17242238 - 17242362
Alignment:
Q  264 tttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacga 363  Q
    ||||||||||| |||| ||||||| |||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||    
T  17242238 tttatatagagtgctaaaccggaccggttcaagaccggtccaatcccatgtgttgtgagcccttagatctagggtttgggatcttggatcaatccaacga 17242337  T
Q  364 tccctgagcgtccctgtgagatccg 388  Q
    |||||||| || |||||||||||||    
T  17242338 tccctgagagttcctgtgagatccg 17242362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Complemental strand, 5802974 - 5802941
Alignment:
Q  329 gatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||||||||||||    
T  5802974 gatctagggtttgggatcttggatcaatccaacg 5802941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 362
Target Start/End: Original strand, 23764216 - 23764252
Alignment:
Q  326 ttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||| |||||||||||||||||||    
T  23764216 ttagatctagggtttggcatcttggatcaatccaacg 23764252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Original strand, 7368335 - 7368385
Alignment:
Q  326 ttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc 376  Q
    ||||||||||||||||| |||||||||||||| |||| | |||| ||||||    
T  7368335 ttagatctagggtttggcatcttggatcaatctaacggttcctgtgcgtcc 7368385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 15853378 - 15853428
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || | ||||||||||||| ||||||    
T  15853378 tgagcctttagatctagggtttggtttcctagatcaatccaacgctccctg 15853428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 16036024 - 16036074
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||| | ||||||    
T  16036024 tgagcctttagatctagggtttggcttcctggatcaatccaatgctccctg 16036074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 16050748 - 16050798
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||| | ||||||    
T  16050748 tgagcctttagatctagggtttggcttcctggatcaatccaatgctccctg 16050798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 141; Significance: 9e-74; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 241 - 393
Target Start/End: Complemental strand, 18836 - 18684
Alignment:
Q  241 tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt 340  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  18836 tgaataaaccggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtctaatcccctgcgttgtgagcctttagatctagggttt 18737  T
Q  341 gggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  18736 gggatcttggatcaatccaacgatccctgagcgtctctgtgagatccgtatcc 18684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 18)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Original strand, 26772842 - 26773001
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||    
T  26772842 aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg 26772941  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg 397  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  26772942 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg 26773001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Original strand, 27283079 - 27283238
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||    
T  27283079 aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg 27283178  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg 397  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  27283179 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg 27283238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 241 - 385
Target Start/End: Original strand, 22897942 - 22898086
Alignment:
Q  241 tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt 340  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22897942 tgaataaaccggcgcattaggcttttatatagagcgctagaacggaccagttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt 22898041  T
Q  341 gggatcttggatcaatccaacgatccctgagcgtccctgtgagat 385  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  22898042 gggatcttggatcaatccaacgatccctgagcgtccctgtgagat 22898086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 33510912 - 33511068
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  33510912 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 33511011  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  33511012 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 33511068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 33526175 - 33526331
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  33526175 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 33526274  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  33526275 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 33526331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 30144273 - 30144428
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  30144273 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 30144371  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||    
T  30144372 gtttgggatcttggatcaatccaacgatccctgagcattcctgtgagatccggatcc 30144428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 30178323 - 30178478
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  30178323 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 30178421  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||    
T  30178422 gtttgggatcttggatcaatccaacgatccctgagcattcctgtgagatccggatcc 30178478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 34494526 - 34494476
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  |||||||||||||||||| ||||||    
T  34494526 tgagcctttagatctagggtttggtttcttggatcaatccaacgctccctg 34494476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 28899289 - 28899243
Alignment:
Q  264 tttatatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||||||| | ||||||||||| ||||||||||||||||||||||    
T  28899289 tttatatagaccactagaccggaccggttcaagaccggtccaatccc 28899243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 28935684 - 28935638
Alignment:
Q  264 tttatatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||||||| | ||||||||||| ||||||||||||||||||||||    
T  28935684 tttatatagaccactagaccggaccggttcaagaccggtccaatccc 28935638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 421
Target Start/End: Complemental strand, 18118909 - 18118872
Alignment:
Q  384 atccgtatcctttgagtgtgggctttgggtttgggcct 421  Q
    ||||||||| ||||||||||||||||||||||||||||    
T  18118909 atccgtatcttttgagtgtgggctttgggtttgggcct 18118872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 421
Target Start/End: Complemental strand, 18129289 - 18129252
Alignment:
Q  384 atccgtatcctttgagtgtgggctttgggtttgggcct 421  Q
    ||||||||| ||||||||||||||||||||||||||||    
T  18129289 atccgtatcttttgagtgtgggctttgggtttgggcct 18129252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 265 - 310
Target Start/End: Complemental strand, 23723686 - 23723641
Alignment:
Q  265 ttatatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    ||||||||| | ||||||||||| ||||||||||||||||||||||    
T  23723686 ttatatagacccctagaccggaccggttcaagaccggtccaatccc 23723641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Complemental strand, 22269888 - 22269842
Alignment:
Q  323 cctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||  || ||||||||||||||| ||||||    
T  22269888 cctttagatctagggtttggcttcctggatcaatccaacgctccctg 22269842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 30956018 - 30956060
Alignment:
Q  268 tatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||| | ||||||||||| ||||||||||||||||||||||    
T  30956018 tatagacccctagaccggaccggttcaagaccggtccaatccc 30956060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 358
Target Start/End: Original strand, 11544885 - 11544962
Alignment:
Q  281 accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatcc 358  Q
    ||||||| |||||||||||||||||||||||| ||||    ||| || |||||||||||||   || |||||||||||    
T  11544885 accggaccggttcaagaccggtccaatccccttcgttcctggccgttggatctagggtttgatctcctggatcaatcc 11544962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 358
Target Start/End: Original strand, 11558944 - 11559021
Alignment:
Q  281 accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatcc 358  Q
    ||||||| |||||||||||||||||||||||| ||||    ||| || |||||||||||||   || |||||||||||    
T  11558944 accggaccggttcaagaccggtccaatccccttcgttcctggccgttggatctagggtttgatctcctggatcaatcc 11559021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 30929143 - 30929176
Alignment:
Q  277 ctagaccggactggttcaagaccggtccaatccc 310  Q
    ||||||||||| ||||||||||||||||||||||    
T  30929143 ctagaccggaccggttcaagaccggtccaatccc 30929176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0252 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: scaffold0252
Description:

Target: scaffold0252; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 238 - 397
Target Start/End: Complemental strand, 1244 - 1085
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    |||||| |||||||||||| |||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1244 aaatgagtaaaccggcgcactagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 1145  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg 397  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| |||||||    
T  1144 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcctttg 1085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 130073 - 129917
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  130073 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 129974  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  129973 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 129917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 113; Significance: 4e-57; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 7987116 - 7987272
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  7987116 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 7987215  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  7987216 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 7987272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 30563682 - 30563526
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  30563682 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 30563583  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  30563582 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 30563526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 27002227 - 27002382
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  27002227 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 27002325  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
T  27002326 gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgagatccggatcc 27002382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 27017733 - 27017888
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  27017733 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 27017831  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
T  27017832 gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgagatccggatcc 27017888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 27192209 - 27192365
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  27192209 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 27192308  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||| ||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  27192309 tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 27192365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 27204062 - 27204218
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  27204062 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 27204161  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||| ||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  27204162 tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 27204218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 27245169 - 27245013
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  27245169 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 27245070  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||| ||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  27245069 tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 27245013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 27257032 - 27256876
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  27257032 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 27256933  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||| ||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  27256932 tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 27256876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 246 - 394
Target Start/End: Complemental strand, 30548403 - 30548255
Alignment:
Q  246 aaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggat 345  Q
    |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||     
T  30548403 aaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctagggtttgggac 30548304  T
Q  346 cttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  30548303 cttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 30548255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 317 - 362
Target Start/End: Original strand, 20133585 - 20133630
Alignment:
Q  317 tgtgagcctttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||    
T  20133585 tgtgagcctttagatctagggtttttgatcttggatcaatccaacg 20133630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 22199284 - 22199239
Alignment:
Q  317 tgtgagcctttagatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||    
T  22199284 tgtgagcctttagatctagggtttttgatcttggatcaatccaacg 22199239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Complemental strand, 22940556 - 22940514
Alignment:
Q  268 tatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||| | ||||||||||| ||||||||||||||||||||||    
T  22940556 tatagaccactagaccggaccggttcaagaccggtccaatccc 22940514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Complemental strand, 23863000 - 23862958
Alignment:
Q  268 tatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||| | ||||||||||| ||||||||||||||||||||||    
T  23863000 tatagaccactagaccggaccggttcaagaccggtccaatccc 23862958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 25178762 - 25178812
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || |||||||||| |||| ||||||    
T  25178762 tgagcctttagatctagggtttggcttcctggatcaatcaaacgctccctg 25178812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Complemental strand, 30721806 - 30721773
Alignment:
Q  277 ctagaccggactggttcaagaccggtccaatccc 310  Q
    ||||||||||| ||||||||||||||||||||||    
T  30721806 ctagaccggaccggttcaagaccggtccaatccc 30721773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 317
Target Start/End: Original strand, 18939635 - 18939671
Alignment:
Q  281 accggactggttcaagaccggtccaatcccctgcgtt 317  Q
    ||||||| |||||||||||||||||||||||| ||||    
T  18939635 accggaccggttcaagaccggtccaatccccttcgtt 18939671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 16)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 17975159 - 17975003
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  17975159 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 17975060  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  17975059 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 17975003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 17990707 - 17990551
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  17990707 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 17990608  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  17990607 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 17990551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 18219688 - 18219844
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  18219688 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 18219787  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  18219788 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 18219844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 18234996 - 18235152
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  18234996 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 18235095  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  18235096 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 18235152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 28333779 - 28333934
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  28333779 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 28333877  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||    
T  28333878 gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgaaatccggatcc 28333934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 28348881 - 28349036
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  28348881 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg 28348979  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    |||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||    
T  28348980 gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgaaatccggatcc 28349036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 28166969 - 28166920
Alignment:
Q  265 ttatatagagcgctagaccggactggttcaagaccggtccaatcccctgc 314  Q
    ||||||||| | ||||||||||| ||||||||||||||||||||||||||    
T  28166969 ttatatagaccactagaccggaccggttcaagaccggtccaatcccctgc 28166920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 14142608 - 14142558
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  14142608 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 14142558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 18525048 - 18525098
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  18525048 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 18525098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 319 - 368
Target Start/End: Complemental strand, 23012643 - 23012594
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccct 368  Q
    ||||||||||||||||||||||||  || ||||||||||||||| |||||    
T  23012643 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccct 23012594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 321 - 369
Target Start/End: Original strand, 19448511 - 19448559
Alignment:
Q  321 agcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  19448511 agcctttagatctagggtttggcttcctggatcaatccaacgctccctg 19448559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 360
Target Start/End: Complemental strand, 15365098 - 15365064
Alignment:
Q  326 ttagatctagggtttgggatcttggatcaatccaa 360  Q
    ||||||||||||||||| |||||||||||||||||    
T  15365098 ttagatctagggtttggcatcttggatcaatccaa 15365064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 4653281 - 4653314
Alignment:
Q  277 ctagaccggactggttcaagaccggtccaatccc 310  Q
    ||||||||||| ||||||||||||||||||||||    
T  4653281 ctagaccggaccggttcaagaccggtccaatccc 4653314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Original strand, 17786865 - 17786905
Alignment:
Q  348 tggatcaatccaacgatccctgagcgtccctgtgagatccg 388  Q
    ||||||||||||||||||||||||| | |||||| ||||||    
T  17786865 tggatcaatccaacgatccctgagctttcctgtgtgatccg 17786905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Original strand, 19088386 - 19088426
Alignment:
Q  348 tggatcaatccaacgatccctgagcgtccctgtgagatccg 388  Q
    ||||||||||||||||||||||||| | |||||| ||||||    
T  19088386 tggatcaatccaacgatccctgagctttcctgtgtgatccg 19088426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Complemental strand, 19364916 - 19364876
Alignment:
Q  348 tggatcaatccaacgatccctgagcgtccctgtgagatccg 388  Q
    ||||||||||||||||||||||||| | |||||| ||||||    
T  19364916 tggatcaatccaacgatccctgagctttcctgtgtgatccg 19364876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16819799 - 16819643
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  16819799 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 16819700  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  16819699 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 16819643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16835040 - 16834884
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  16835040 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 16834941  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  16834940 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 16834884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16875021 - 16874865
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  16875021 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 16874922  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  16874921 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 16874865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 32059536 - 32059692
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  32059536 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgtagtgagcccttagatctaggg 32059635  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  32059636 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 32059692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 32044340 - 32044496
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||    
T  32044340 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgtagtgagcccttagatctaggg 32044439  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||| ||||||||| ||||    
T  32044440 tttgggaccttggatcaatccaacggtccctgagtatccctgggagatccgtttcct 32044496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 237 - 388
Target Start/End: Original strand, 35763430 - 35763580
Alignment:
Q  237 gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg 336  Q
    |||||||| ||||||||||  |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||    
T  35763430 gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagccattagatctagg 35763528  T
Q  337 gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccg 388  Q
    |||||||||||||||||||||||||||||||||||| | ||||||| |||||    
T  35763529 gtttgggatcttggatcaatccaacgatccctgagcattcctgtgaaatccg 35763580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 10116449 - 10116403
Alignment:
Q  264 tttatatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||||||| | ||||||||||| ||||||||||||||||||||||    
T  10116449 tttatatagaccactagaccggaccggttcaagaccggtccaatccc 10116403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 21693928 - 21693878
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  21693928 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 21693878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 21708709 - 21708659
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  21708709 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 21708659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 39884674 - 39884707
Alignment:
Q  329 gatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||||||||||||    
T  39884674 gatctagggtttgggatcttggatcaatccaacg 39884707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 39900250 - 39900283
Alignment:
Q  329 gatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||||||||||||    
T  39900250 gatctagggtttgggatcttggatcaatccaacg 39900283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 376
Target Start/End: Complemental strand, 29439389 - 29439332
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc 376  Q
    ||||||||||||||||||||||||  || |||||||||| ||||   |||||||||||    
T  29439389 tgagcctttagatctagggtttggcttcctggatcaatctaacggctcctgagcgtcc 29439332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 4486748 - 4486592
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||||    
T  4486748 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaattccctgcgttgtgagcccttagatctaggg 4486649  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  4486648 tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 4486592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 17896831 - 17896873
Alignment:
Q  268 tatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||| | ||||||||||| ||||||||||||||||||||||    
T  17896831 tatagacccctagaccggaccggttcaagaccggtccaatccc 17896873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 19697664 - 19697697
Alignment:
Q  329 gatctagggtttgggatcttggatcaatccaacg 362  Q
    ||||||||||||||||||||||||||||| ||||    
T  19697664 gatctagggtttgggatcttggatcaatctaacg 19697697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1536 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: scaffold1536
Description:

Target: scaffold1536; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 1040 - 1196
Alignment:
Q  238 aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg 337  Q
    ||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||    
T  1040 aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg 1139  T
Q  338 tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    ||| ||| ||||||||||||||||| |||||| |  |||||||||||||||| ||||    
T  1140 tttaggaccttggatcaatccaacggtccctgtgtatccctgtgagatccgtttcct 1196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 295 - 397
Target Start/End: Original strand, 47767122 - 47767224
Alignment:
Q  295 agaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct 394  Q
    |||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||  |||||||||||||||| ||||    
T  47767122 agaccggtccaatcccttgcgttgtgagcccttagatctagggtttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct 47767221  T
Q  395 ttg 397  Q
    |||    
T  47767222 ttg 47767224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 16653735 - 16653689
Alignment:
Q  264 tttatatagagcgctagaccggactggttcaagaccggtccaatccc 310  Q
    |||||||||| | ||||||||||| ||||||||||||||||||||||    
T  16653735 tttatatagaccactagaccggaccggttcaagaccggtccaatccc 16653689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Original strand, 16404800 - 16404846
Alignment:
Q  323 cctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||  || ||||||||||||||| ||||||    
T  16404800 cctttagatctagggtttggcttcctggatcaatccaacgctccctg 16404846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 20344382 - 20344332
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || |||||||||| |||| ||||||    
T  20344382 tgagcctttagatctagggtttggtttcctggatcaatctaacgctccctg 20344332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 319 - 393
Target Start/End: Original strand, 179180 - 179254
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc 393  Q
    ||||||||||||||||||||||||  || |||||||||||||||||| |||||||||| ||||||||||||||||    
T  179180 tgagcctttagatctagggtttggcttcctggatcaatccaacgatctctgagcgtccatgtgagatccgtatcc 179254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 98267 - 98317
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||||||||||    
T  98267 tgagcctttagatctagggtttggcttcctggatcaatccaacgatccctg 98317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0750 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0750
Description:

Target: scaffold0750; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 202 - 152
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  202 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0347 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0347
Description:

Target: scaffold0347; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 17295 - 17245
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||||    
T  17295 tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg 17245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0184 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0184
Description:

Target: scaffold0184; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 367
Target Start/End: Original strand, 21881 - 21929
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccc 367  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||    
T  21881 tgagcctttagatctagggtttggtttcctggatcaatccaacgctccc 21929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0078 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0078
Description:

Target: scaffold0078; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 367
Target Start/End: Complemental strand, 50963 - 50915
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccc 367  Q
    ||||||||||||||||||||||||  || ||||||||||||||| ||||    
T  50963 tgagcctttagatctagggtttggtttcctggatcaatccaacgctccc 50915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1665 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1665
Description:

Target: scaffold1665; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 372
Target Start/End: Complemental strand, 881 - 838
Alignment:
Q  329 gatctagggtttgggatcttggatcaatccaacgatccctgagc 372  Q
    ||||||||||||||| |||||||||||||||||| | |||||||    
T  881 gatctagggtttggggtcttggatcaatccaacggttcctgagc 838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0740 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0740
Description:

Target: scaffold0740; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Original strand, 945 - 991
Alignment:
Q  323 cctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||  || ||||||||||||||| ||||||    
T  945 cctttagatctagggtttggcttcctggatcaatccaacgctccctg 991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 6705 - 6655
Alignment:
Q  319 tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg 369  Q
    ||||||||||||||||||||||||  || |||||||||| |||| ||||||    
T  6705 tgagcctttagatctagggtttggtttcctggatcaatctaacgctccctg 6655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0235 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0235
Description:

Target: scaffold0235; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Complemental strand, 259 - 209
Alignment:
Q  326 ttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc 376  Q
    ||||||||||||||||| |||||||||| |||||||| | |||| ||||||    
T  259 ttagatctagggtttggcatcttggatctatccaacggttcctgtgcgtcc 209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0225 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0225
Description:

Target: scaffold0225; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Complemental strand, 306 - 273
Alignment:
Q  277 ctagaccggactggttcaagaccggtccaatccc 310  Q
    ||||||||||| ||||||||||||||||||||||    
T  306 ctagaccggaccggttcaagaccggtccaatccc 273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0393
Description:

Target: scaffold0393; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 393
Target Start/End: Original strand, 6100 - 6212
Alignment:
Q  281 accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgt 380  Q
    ||||||| |||||||  | |||||||| ||||  | | || ||||||||||||||| ||| |  || |||||| |||||||||||||||||| | || ||    
T  6100 accggaccggttcaattctggtccaattccctttgatctgcgcctttagatctaggtttttgcttcctggatcgatccaacgatccctgagctttcccgt 6199  T
Q  381 gagatccgtatcc 393  Q
    | |||||| ||||    
T  6200 gtgatccggatcc 6212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University