View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10705_low_5 (Length: 260)

Name: NF10705_low_5
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10705_low_5
NF10705_low_5
[»] chr7 (2 HSPs)
chr7 (51-205)||(44867248-44867402)
chr7 (19-54)||(44870000-44870035)
[»] chr1 (1 HSPs)
chr1 (182-260)||(32487776-32487854)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 51 - 205
Target Start/End: Original strand, 44867248 - 44867402
Alignment:
Q  51 gtttggattctaaaatttgaaatgttaacgtgttttggagggtatcacgggnnnnnnnngccgttcagattctataatccgagttgtatagagtgcatga 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||| ||||||||||||||||    
T  44867248 gtttggattctaaaatttgaaatgttaacgtgttttggagggtatcacgggttttttttgccgttcagattctataatccgagctgtatagagtgcatga 44867347  T
Q  151 taaattaaataggatgggaaaagtttatggctatttctttttcacattgtttctt 205  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  44867348 taaattaaataggatgggaaaagtttatggctatttcttttccacattgtttctt 44867402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 44870035 - 44870000
Alignment:
Q  19 tttctgttatcacttattatcaatcctttaaagttt 54  Q
    |||||||||| |||||||||||||||||||||||||    
T  44870035 tttctgttataacttattatcaatcctttaaagttt 44870000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 260
Target Start/End: Complemental strand, 32487854 - 32487776
Alignment:
Q  182 tatttctttttcacattgtttcttaatcatcatgttattacaaaatgccgcctaatcaagatcttccatccctgtttct 260  Q
    |||||||| |||| |||||  | ||||||||||||||| | ||| ||| ||||||| ||||||||||||| ||| ||||    
T  32487854 tatttcttgttcatattgtgacataatcatcatgttatgaaaaattgcagcctaattaagatcttccatctctgcttct 32487776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University