View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10696_low_6 (Length: 243)

Name: NF10696_low_6
Description: NF10696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10696_low_6
NF10696_low_6
[»] chr6 (1 HSPs)
chr6 (15-234)||(34058174-34058391)


Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 234
Target Start/End: Original strand, 34058174 - 34058391
Alignment:
Q  15 aaaaacaacctttgagggatcaattaacagagactataataacacatgttaataaaaatgcaaactttattgataaattagattaatgaagcnnnnnnnn 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            
T  34058174 aaaaacaacctttgagggatcaattaacagagactataataacacatgttaataaaaatgcaaactttattgataaattagattaatgaagcaaaaaaaa 34058273  T
Q  115 nngaaatgggtcggtaaaagaaagatgaaagttgaagaaattacaggaatgaagtgatgggtgtttcttgagctggaactgagagcttgagctgcttcaa 214  Q
      |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34058274 --gaaatgggtcggtaaaagaaagatgaaaattgaagaaattacaggaatgaagtgatgggtgtttcttgagctggaactgagagcttgagctgcttcaa 34058371  T
Q  215 tggcgtcttggtcttcatct 234  Q
    ||||||||||||||||||||    
T  34058372 tggcgtcttggtcttcatct 34058391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University