View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10683_low_8 (Length: 279)

Name: NF10683_low_8
Description: NF10683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10683_low_8
NF10683_low_8
[»] chr8 (1 HSPs)
chr8 (6-179)||(5663561-5663734)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 6 - 179
Target Start/End: Original strand, 5663561 - 5663734
Alignment:
Q  6 ggacgttggagtttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaataggtttattctattgtacttgatttatttctaattgtttt 105  Q
    |||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||| |||||    
T  5663561 ggacgttggagtttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacaggtttattctattgtccttgatttatttctaatggtttt 5663660  T
Q  106 tatgctactgttgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctgtatactgttaattg 179  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||    
T  5663661 tatgctactgttgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgtatatttttaattg 5663734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University