View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10667_low_6 (Length: 323)

Name: NF10667_low_6
Description: NF10667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10667_low_6
NF10667_low_6
[»] chr1 (2 HSPs)
chr1 (1-202)||(5860113-5860314)
chr1 (257-304)||(5860369-5860416)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 5860113 - 5860314
Alignment:
Q  1 attaatcaggtggtccatattttttgcagttttcttttgaagttggtattctcaaagtttttggaaatctagagccaaggttgagggaagagctaaagaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  5860113 attaatcaggtggtccatattttttgcagttttcttttgaagttggtattctcaaagtttttggaaatctagagccgaggttgagggaagagctaaagaa 5860212  T
Q  101 gaattattggattgttgacaatggttacaattcttttccaactcaaattcctggtacacaatacaaaaaggcactcttggtaagtactatattaattcaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5860213 gaattattggattgttgacaatggttacaattcttttccaactcaaattcctggtacacaatacaaaaaggcactcttggtaagtactatattaattcaa 5860312  T
Q  201 ga 202  Q
    ||    
T  5860313 ga 5860314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 5860369 - 5860416
Alignment:
Q  257 gaaggcaagagagaaacttggaagtattttgaaggaaataattagtga 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  5860369 gaaggcaagagagaaacttggaagtattttgaaggaaataattagtga 5860416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University