View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10666_low_35 (Length: 229)

Name: NF10666_low_35
Description: NF10666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10666_low_35
NF10666_low_35
[»] chr4 (1 HSPs)
chr4 (67-207)||(54951202-54951344)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 67 - 207
Target Start/End: Complemental strand, 54951344 - 54951202
Alignment:
Q  67 atgagatgaataagaaacggacgaagggcatataaaagtgaga-aaaatatcataatacaaaatcccaacagtt-aatcgatgattcttgtggttagata 164  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  54951344 atgagatgaataagaaacggacgaagggcatataaaagtgagataaaatatcataatacaaaatcccaacagttgaatcgatgattcttgtggttagata 54951245  T
Q  165 gattaataatttattgaactaacttatataagcttatttgatc 207  Q
    ||||||||||||||||||||||||||||||||||| |||||||    
T  54951244 gattaataatttattgaactaacttatataagcttgtttgatc 54951202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University