View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10660_low_38 (Length: 229)

Name: NF10660_low_38
Description: NF10660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10660_low_38
NF10660_low_38
[»] chr1 (1 HSPs)
chr1 (7-196)||(16862156-16862339)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 7 - 196
Target Start/End: Original strand, 16862156 - 16862339
Alignment:
Q  7 gacttcccacattccatgccttactgcaggcttgctttgtgtgagtcggatagtttcttgcttgcttggctttgtcgtgctagcaggttcatcaccttcc 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| |||||||    
T  16862156 gacttcacacattccatgccttactgcaggcttgctttgtgtgagtcagataggttcttgcttgcttggctctgtcgtgctagcaggttcattaccttcc 16862255  T
Q  107 tctttaaatcaactttgtccttaaggttgaatatagggtcctgctcttcacattcctagttgggcataggcaatggatgtagaagaccat 196  Q
    ||||||||||||      |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||    
T  16862256 tctttaaatcaa------ccttaaggttgaatatagggtcctgctctttacattcctggttgggcataggcaatggatgtagaagaccat 16862339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University