View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10658_low_29 (Length: 238)

Name: NF10658_low_29
Description: NF10658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10658_low_29
NF10658_low_29
[»] chr5 (1 HSPs)
chr5 (14-222)||(27779664-27779872)
[»] chr3 (1 HSPs)
chr3 (101-174)||(46261987-46262060)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 27779872 - 27779664
Alignment:
Q  14 agatacaataaatggtttaaaatgaggatagcaatcaatgagatctttgaaaaggaaagatatcataaaatgaaaagtaattaatcaaatacctttgcaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||    
T  27779872 agatacaataaatggtttaaaatgaggatagcaatcaatgagatctttggaaaacaaagatatcataaaatgaaaagtaattaatcaaatacctttgcaa 27779773  T
Q  114 caaacggcggtttggttcaggaaaagtgtcacatattgctgtacgcatagcagaaaccctattctcacgtgcagttcctaaaagatgtgatagattcaaa 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
T  27779772 caaacggcggtttggttcaggaaaagtgtcacatattgctgtacgcatagcagaaaccctattctcacgtgcagttcctaaaatatgtgataggttcaaa 27779673  T
Q  214 tgatgaatg 222  Q
    |||||||||    
T  27779672 tgatgaatg 27779664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 46261987 - 46262060
Alignment:
Q  101 aatacctttgcaacaaacggcggtttggttcaggaaaagtgtcacatattgctgtacgcatagcagaaacccta 174  Q
    ||||||||||||| || ||||| ||||||||||| |||||||||  |||||||| |||||||| || |||||||    
T  46261987 aatacctttgcaataagcggcgatttggttcagggaaagtgtcatttattgctgcacgcatagaagcaacccta 46262060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University