View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10654_high_1 (Length: 381)

Name: NF10654_high_1
Description: NF10654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10654_high_1
NF10654_high_1
[»] chr3 (1 HSPs)
chr3 (235-381)||(9586597-9586743)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 235 - 381
Target Start/End: Original strand, 9586597 - 9586743
Alignment:
Q  235 aacaactaccatattgttctatcttttatgttttcagacattaagaaattgctgccgcattaagaacattttatcatctaaatcgtaactcaaatcttaa 334  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  9586597 aacaactaccatattgttctatcttttatgttttcagacattaagaaattgttgccgcattaagaacattttatcatctaaatcgtaactcaaatcttaa 9586696  T
Q  335 aaaatcaaatgccaaaccctctaatgcgatgatacaactatttaaaa 381  Q
    ||||||||||| ||||||||||||||||||||| |||||||||||||    
T  9586697 aaaatcaaatgacaaaccctctaatgcgatgatccaactatttaaaa 9586743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University