View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10651_low_30 (Length: 213)

Name: NF10651_low_30
Description: NF10651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10651_low_30
NF10651_low_30
[»] chr6 (2 HSPs)
chr6 (22-145)||(2698540-2698663)
chr6 (143-201)||(2698441-2698499)


Alignment Details
Target: chr6 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 22 - 145
Target Start/End: Complemental strand, 2698663 - 2698540
Alignment:
Q  22 ctatttcttttaaaatggttgatcaatatcgtcaccatcgttgatgtacagttgatatagatatgaatcatttgacagtttgaggttgtgctttggattg 121  Q
    ||||||| |||||||| ||||||| ||||||||||| || |||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||| ||    
T  2698663 ctatttcgtttaaaatagttgatcgatatcgtcaccgtcattgatgtatagttgatataggtatgaatcatttgacagtttgaggttttgctttggactg 2698564  T
Q  122 taatgcttgaaagggcggtgtctt 145  Q
    |||||||||||||| |||||||||    
T  2698563 taatgcttgaaaggacggtgtctt 2698540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 143 - 201
Target Start/End: Complemental strand, 2698499 - 2698441
Alignment:
Q  143 cttatgtgtgagtgtttttgtcatagtaaatggtgggtacgtgtgcaattgcttctgtg 201  Q
    |||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||    
T  2698499 cttatgtgtgggtgttttcgtcatagtaaatggtgggtacgtgtgcaactgcttctgtg 2698441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University