View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10642_low_12 (Length: 235)

Name: NF10642_low_12
Description: NF10642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10642_low_12
NF10642_low_12
[»] chr8 (1 HSPs)
chr8 (79-220)||(13983071-13983212)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 13983212 - 13983071
Alignment:
Q  79 cttcattggttcttctctcgtagccctctttcatttctcctatgtgttgttttacctttaggtcttaaatgagatattggttatatctattgtttataaa 178  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||    
T  13983212 cttcattggttcttctctcgtagctctctttcatttctcctatgtgttgttttacttttaggtcttaaatgagatcttggttatatctattgtttataaa 13983113  T
Q  179 tttaattatacatcacttgttttcttgatttttaatagaact 220  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  13983112 tttaattatacatcacttgttttcttgatttttaatagaact 13983071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University