View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1063_low_53 (Length: 219)

Name: NF1063_low_53
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1063_low_53
NF1063_low_53
[»] chr4 (1 HSPs)
chr4 (35-169)||(19276917-19277053)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 35 - 169
Target Start/End: Original strand, 19276917 - 19277053
Alignment:
Q  35 cacataatcaatcaaaatccaaatcacctcaacaaaaggttttgttaatttaatataaacaactactagtactattatttgtttgtcactgttgtttagt 134  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  19276917 cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatgtaaacaactactagtactattatttgtttgtcactgttgtttagt 19277016  T
Q  135 taa--tctctctctctttttgtctcctaaaccaagac 169  Q
    |||  ||||||||||||||||||||||||||||||||    
T  19277017 taatctctctctctctttttgtctcctaaaccaagac 19277053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University