View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1063_low_33 (Length: 321)

Name: NF1063_low_33
Description: NF1063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1063_low_33
NF1063_low_33
[»] chr2 (2 HSPs)
chr2 (132-187)||(3909359-3909414)
chr2 (271-321)||(3909323-3909373)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 3909359 - 3909414
Alignment:
Q  132 atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctc 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3909359 atctgcttctttggctctaaatcaatggcatgatctgtcagagttcaatcctcctc 3909414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 3909323 - 3909373
Alignment:
Q  271 tggtggtaatggaagtgctggtcctggtgctagtggatctgcttctttggc 321  Q
    |||||||||||| |||| |||| |||| |||||||||||||||||||||||    
T  3909323 tggtggtaatggtagtgttggtgctggggctagtggatctgcttctttggc 3909373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University