View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10638_low_27 (Length: 242)

Name: NF10638_low_27
Description: NF10638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10638_low_27
NF10638_low_27
[»] chr7 (1 HSPs)
chr7 (1-211)||(46017092-46017302)


Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 46017092 - 46017302
Alignment:
Q  1 tccgtcagggttgaagggaacggcgcctaggtcgaatgttgcagctgaaggcatttttggtgaatgagagaatgtggaagaactgaaagataagtgtgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46017092 tccgtcagggttgaagggaacggcgcctaggtcgaatgttgcagctgaaggcatttttggtgaatgagagaatgtggaagaactgaaagataagtgtgga 46017191  T
Q  101 acaaatgggcctgtttactgggccaatataaacttttttaacccaattaactgttttactatctacacatcctttttaacacnnnnnnnagattaggaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||       |||||||||||    
T  46017192 acaaatgggcctgtttactgggccaatataaacttttttaacccaattaactgttttactatctacacctcctttttaacactatttttagattaggaaa 46017291  T
Q  201 caatagaatga 211  Q
    |||||||||||    
T  46017292 caatagaatga 46017302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University