View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10636_low_18 (Length: 238)

Name: NF10636_low_18
Description: NF10636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10636_low_18
NF10636_low_18
[»] chr1 (2 HSPs)
chr1 (12-73)||(43293978-43294039)
chr1 (129-220)||(43294038-43294119)


Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 12 - 73
Target Start/End: Original strand, 43293978 - 43294039
Alignment:
Q  12 agcagagacaatgttgtcaacacttgattttatgttattgaaatttgagctataagtatgta 73  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  43293978 agcaaagacaatgttgtcaacacttgattttatattattgaaatttgagctataagtatgta 43294039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 220
Target Start/End: Original strand, 43294038 - 43294119
Alignment:
Q  129 tacaatgtagtagtagctagctaagacattatcaataactcccagaaagttgcatttaatatagccttgtagatcacaatttgctatctctt 220  Q
    |||||||||||||||||||||||||||| |||||          ||||||||||||||||||||||||||||||||||||||||||||||||    
T  43294038 tacaatgtagtagtagctagctaagacaatatca----------gaaagttgcatttaatatagccttgtagatcacaatttgctatctctt 43294119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University