View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10626_low_6 (Length: 243)

Name: NF10626_low_6
Description: NF10626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10626_low_6
NF10626_low_6
[»] chr7 (1 HSPs)
chr7 (111-233)||(29772104-29772230)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 111 - 233
Target Start/End: Original strand, 29772104 - 29772230
Alignment:
Q  111 ccaacaatttcttcgatgatcccatgtcattggccaagcatcttagtcattaactcgatcatttagtataaatcaaatgtaatcagttcatcttgat--- 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       
T  29772104 ccaacaatttcttcgatgatcccatgtcattggccaagcatcttagtcattaactcgatcatttagtataaatcaaatgtaatcagttgatcttgattat 29772203  T
Q  208 -catacactcactcgattattcctatg 233  Q
     ||||||||||||||||||||||||||    
T  29772204 acatacactcactcgattattcctatg 29772230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University