View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10621_low_39 (Length: 222)

Name: NF10621_low_39
Description: NF10621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10621_low_39
NF10621_low_39
[»] chr2 (1 HSPs)
chr2 (1-210)||(41023069-41023278)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 41023278 - 41023069
Alignment:
Q  1 ccaccgccgtcaacaatgggtttcttcgacctaaacataccttacccttcacccaccacaaaaccttctaaatccaccatcgaaaacaaccgaacgcgcc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41023278 ccaccgccgtcaacaatgggtttcttcgacctaaacataccttacccttcacccaccacaaaaccttctaaatccaccatcgaaaacaaccgaacgcgcc 41023179  T
Q  101 tcgccgttaaagcaatggaattaggttacacaggaatcgcttacaaccgcacgatgaaaggcgtaatgtccgataaccatcgttgctcaatctccccact 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  41023178 tcgccgttaaagcaatggaattaggttacacaggaatcgcttacaaccgcacgatgaaaggcttaatgtccgataaccatcgttgctcaatctccccact 41023079  T
Q  201 ttctctctct 210  Q
    ||||||||||    
T  41023078 ttctctctct 41023069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University