View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10618_low_5 (Length: 372)

Name: NF10618_low_5
Description: NF10618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10618_low_5
NF10618_low_5
[»] chr5 (1 HSPs)
chr5 (33-355)||(43366671-43366993)


Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 33 - 355
Target Start/End: Original strand, 43366671 - 43366993
Alignment:
Q  33 aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43366671 aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgatgagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaa 43366770  T
Q  133 gttacacacagcagcagaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat 232  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43366771 gttacacacagcagcaaaatggaatgaggaatgtaattgaagtagaaggatgaagagcatttacaataaaaggggaaggagcgaagagagagagcatgat 43366870  T
Q  233 gaaaagaaggagaaggcagacggagatggcggaaatgaggaggcggtgaatgagacgacggcggaggaaactggcaagaaggagtccgatgagtcttctg 332  Q
    |||||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  43366871 gaaaagaaagagaaggcagacggagatggaggaaatgaggaggcgatgaatgagacgacggcggaggaaactggaaagaaggagtccgatgagtcttctg 43366970  T
Q  333 gacttgtctgtcttctttctctt 355  Q
    |||||||||||||||||||||||    
T  43366971 gacttgtctgtcttctttctctt 43366993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University