View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10615_low_10 (Length: 250)

Name: NF10615_low_10
Description: NF10615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10615_low_10
NF10615_low_10
[»] chr5 (2 HSPs)
chr5 (145-242)||(41822999-41823098)
chr5 (1-81)||(41823162-41823242)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 41823098 - 41822999
Alignment:
Q  145 gacagtttgaattgcatgacttgtgatttatgtattgtgttctctagtttttatttg--gtgattttgatctttcactataattacctatcacctatgct 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| ||||||||    
T  41823098 gacagtttgaattgcatgacttgtgatttatgtattgtgttctctagtttttatttggtgtgattttgatctttcactataattacctatctcctatgct 41822999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 41823242 - 41823162
Alignment:
Q  1 cttattcttatatcaattaatttgcaaaaatagaatatgcttaatttactatttgatgtttattgttatgatcaacgagtc 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  41823242 cttattcttatatcaattaatttgcaaaaatagaatatgcttaatttactatttgatgtttattgttatgatcaatgagtc 41823162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University