View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10611_low_29 (Length: 248)

Name: NF10611_low_29
Description: NF10611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10611_low_29
NF10611_low_29
[»] chr5 (2 HSPs)
chr5 (129-219)||(41110743-41110833)
chr5 (5-55)||(41110619-41110669)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 129 - 219
Target Start/End: Original strand, 41110743 - 41110833
Alignment:
Q  129 ggttggtgtcttttggattgaaacaagatgaaggtgacggtcagtagtagtcattcaataatccaacgacgtcgttttcacttattttcca 219  Q
    ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  41110743 ggttgatgtcttttggattgaaacaagatgaagctgacggtcagtagtagtcattcaataatccaacgacgtcgttttcgcttattttcca 41110833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 55
Target Start/End: Original strand, 41110619 - 41110669
Alignment:
Q  5 gagagatgaaggaagaagcgtagtaaccatttttgttatcttgaaaatggg 55  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  41110619 gagagaagaaggaagaagcgtagtaaccatttttgttatcttgaaaatggg 41110669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University