View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10602_low_50 (Length: 262)

Name: NF10602_low_50
Description: NF10602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10602_low_50
NF10602_low_50
[»] chr4 (1 HSPs)
chr4 (16-251)||(41978418-41978653)


Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 41978418 - 41978653
Alignment:
Q  16 caagattcaccgctatctcccggaaagtatacaaaatccaattcaaagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgcta 115  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41978418 caagattcaccgctatctcccgggaagtatacaaaatccaattcaaagaaaaatatgggaagtctcgatgatgttaggtctaatggttggttggatgcta 41978517  T
Q  116 tgaaggcatcttcgcctccaaggaagaaattggtactcaaaggttcgagcgctcaggttgcttcaattgactttgacatggaagattataatttatggat 215  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  41978518 tgaaggcatcttcgcctccaaggaagaaatcggtactcaaaggttcgagcgctctggttgcttcaattgactttgacatggaagattataatttatggat 41978617  T
Q  216 ggtatggtttatttctactaattaatttctgcctat 251  Q
    ||||||||||||||||||||||||||||||||||||    
T  41978618 ggtatggtttatttctactaattaatttctgcctat 41978653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University