View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10597_high_2 (Length: 242)

Name: NF10597_high_2
Description: NF10597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10597_high_2
NF10597_high_2
[»] chr5 (1 HSPs)
chr5 (85-224)||(8629798-8629937)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 85 - 224
Target Start/End: Original strand, 8629798 - 8629937
Alignment:
Q  85 ataagataaggttatagatgaatttcattttcatttgtttgattgttttgtgaagttaattgtaaaggggtgtttttgcaatgcctgatgattcatactg 184  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  8629798 ataagataaggttataaatgaatttcattttcatttgtttgattgttttgtgaagttaattgtaaaggggtgtttttgcaatgtctgatgattcatactg 8629897  T
Q  185 catctatgnnnnnnnnnggttggtgtttacctagactttg 224  Q
    ||||||||         |||||||||||||||||||||||    
T  8629898 catctatgtttttttttggttggtgtttacctagactttg 8629937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University